1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

viral infection

" in MedChemExpress (MCE) Product Catalog:

101

Inhibitors & Agonists

5

Screening Libraries

1

Fluorescent Dye

2

Biochemical Assay Reagents

6

Peptides

1

Inhibitory Antibodies

12

Natural
Products

3

Isotope-Labeled Compounds

1

Click Chemistry

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-156702

    HBV Infection
    HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections .
    HBV-IN-38
  • HY-117582

    Reverse Transcriptase HIV Infection
    Elvucitabine is an L-nucleoside analogue. Elvucitabine is a potent nucleoside reverse transcriptase (RT) inhibitor. Elvucitabine can be used in research of viral infection .
    Elvucitabine
  • HY-W676876

    HBV Infection
    Oxynitidine is an HBV inhibitor (ID50=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .
    Oxynitidine
  • HY-139179

    STING Infection Cancer
    STING agonist-14 (compound 12b) is a potent STING agonist that is efficacious across species. STING agonist-14 could activate the pathway by directly binding human STING. STING agonist-14 can be used for the research of tumours or viral infections .
    STING agonist-14
  • HY-148328

    Casein Kinase Infection Inflammation/Immunology Cancer
    CK2-IN-4 (compound 5) is a protein kinase (CK2) inhibitor (IC50=8.6 µM). CK2-IN-4 has good potential for research in the areas of cancer, viral infections and glomerulonephritis .
    CK2-IN-4
  • HY-50001
    Nucleozin
    4 Publications Verification

    Influenza Virus Infection
    Nucleozin, a potent inhibitor of influenza A virus infection, induces the formation of nucleoprotein (NP) aggregates and antagonizes its nuclear accumulation, leading to cessation of viral replication. Nucleozin impedes influenza A virus replication in vitro with a nanomolar EC50 .
    Nucleozin
  • HY-136733

    Ac-Asp-Asn-Leu-Asp-CHO

    Caspase Infection Neurological Disease
    Ac-DNLD-CHO (Ac-Asp-Asn-Leu-Asp-CHO) is a Caspase-3/7 inhibitor (IC50: 9.89, 245 nM respectively; Ki app: 0.68, 55.7 nM respectively). Ac-DNLD-CHO can be used for research of caspase-mediated apoptosis diseases, such as neurodegenerative disorders and viral infection diseases .
    Ac-DNLD-CHO
  • HY-N8393

    Bacterial Fungal Infection
    Ascr#18, an ascaroside, is a hormone of nematodes. Ascr#18 is expressed during nematode development. Ascr#18 increases resistance in Arabidopsis, tomato, potato and barley to viral, bacterial, oomycete, fungal and nematode infections .
    Ascr#18
  • HY-147240

    ADX-629

    Others Infection Cardiovascular Disease Inflammation/Immunology
    Acloproxalap is a quinoline-based aldehyde scavenger that can be used in studies of diseases with toxic aldehyde accumulation, such as inflammatory diseases of the eye and skin, respiratory diseases such as pneumonia, organ diseases, and viral infection-related syndromes .
    Acloproxalap
  • HY-143768

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-14 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-14 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-14 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113620948A, compound 1-c) .
    Cap-dependent endonuclease-IN-14
  • HY-143769

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-15 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-15 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-15 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113226327A, compound c-1) .
    Cap-dependent endonuclease-IN-15
  • HY-126419

    SARS-CoV PKC Infection
    Kobophenol A, an oligomeric stilbene, blocks the interaction between the ACE2 receptor and S1-RBD with an IC50 of 1.81 μM and inhibits SARS-CoV-2 viral infection in cells with an EC50 of 71.6 μM. Kobophenol A inhibits the activity of partially purified rat brain protein kinase C (PKC) with an IC50 of 52 µM .
    Kobophenol A
  • HY-144068

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-25 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-25 is a macrocyclic pyridotriazine derivative. Cap-dependent endonuclease-IN-25 has the potential for the research of viral infections caused by viruses belonging to the Orthomyxoviridae family (extracted from patent WO2020075080A1, compound 4) .
    Cap-dependent endonuclease-IN-25
  • HY-152027

    HSP Apoptosis Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-18 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-18 has effective Hsp90 inhibitory activity with an IC50 value of 0.39 μM. HSP90-IN-18 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-18
  • HY-152028

    HSP Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-19 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-19 has effective Hsp90 inhibitory activity with an IC50 value of 0.27 μM. HSP90-IN-19 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-19
  • HY-152219

    CDK Infection Cancer
    CLK1-IN-2 is metabolically stable Clk1 inhibitor. CLK1-IN-2 has selectivity for Clk1 with an IC50 value of 1.7 nM. CLK1-IN-2 can be used for the research of tumour, Duchenne's muscular dystrophy and viral infections such as HIV-1 and influenza .
    CLK1-IN-2
  • HY-160548

    mTOR Infection Neurological Disease Metabolic Disease Inflammation/Immunology Cancer
    mTOR inhibitor-18 (Example 106) is a mTOR inhibitor. mTOR inhibitor-18 can be used for mTOR related research, such as cancer, immune disorders, cardiovascular disease, viral infection, inflammation, metabolism/endocrine function disorders and neurological disorders .
    mTOR inhibitor-18
  • HY-149050

    Influenza Virus SARS-CoV Infection
    Viral polymerase-IN-1 hydrochloride, a Gemcitabine (HY-17026) derivative, potently inhibits influenza A and B viruses infection with IC90 values of 11.4-15.9 μM. Viral polymerase-IN-1 hydrochloride is active against SARS-CoV-2 infection. Viral polymerase-IN-1 hydrochloride suppresses influenza virus infection by affecting viral RNA replication/transcription in cells .
    Viral polymerase-IN-1 hydrochloride
  • HY-143757

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-10 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-10 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo pharmacokinetic and in vivo pharmacodynamic properties, and better hepatic microsomal stability. Cap-dependent endonuclease-IN-10 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2021129799A1, compound 1-1) .
    Cap-dependent endonuclease-IN-10
  • HY-142932

    Btk Neurological Disease Inflammation/Immunology Cancer
    BTK-IN-6 is a potent inhibitor of Bruton's Tyrosine Kinase (BTK). BTK is a member of the Tec family of tyrosine kinases and plays an important role in the regulation of early B-cell development and mature B-cell activation and survival. BTK-IN-6 has the potential for the research of immune disorders, cancer, cardiovascular diseases, viral infections, inflammation, metabolism/endocrine function disorders, and neurological disorders (extracted from patent WO2021136219A1, compound 8) .
    BTK-IN-6
  • HY-148104

    Others Infection Neurological Disease Metabolic Disease Inflammation/Immunology Cancer
    ACSS2-IN-2 is an acyl-CoA synthetase short-chain family member 2 (ACSS2) inhibitor. ACSS2-IN-2 can inhibit ACSS2 activity with an IC50 value of 3.8 nM. ACSS2-IN-2 can be used for the research of several diseases, such as viral infection, metabolic disorders, neuropsychiatric diseases, inflammatory/autoimmune conditions and cancer .
    ACSS2-IN-2
  • HY-B1056

    Propazol; 2-Benzimidazolepropionic acid

    Bacterial Infection
    Procodazole is a non-specific active immunoprotective agent against viral and bacterial infections, used as a potentiator.
    Procodazole
  • HY-107902

    HBV HCV HIV Influenza Virus Infection
    RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
    RIG-1 modulator 1
  • HY-B0984A

    STING Infection Cancer
    Fendiline is a STING agonist and has tumor growth inhibitory activity. Fendiline can be used for research on cancer and viral infections .
    Fendiline
  • HY-N0677

    Influenza Virus Infection Inflammation/Immunology Cancer
    Dehydroandrographolide succinate, extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect .
    Dehydroandrographolide succinate
  • HY-157082

    Enterovirus Infection
    ZHSI-1 is an EV71 (Enterovirus 71) inhibitor that inhibits EV71/CVA16 replication and virus-induced pyroptosis associated with viral pathogenesis. ZHSI-1 effectively prevents EV71 infection in neonatal and young mice in animal models. ZHSI-1 can be used to study viral infections such as hand, foot and mouth disease (HFMD) .
    ZHSI-1
  • HY-148781

    HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
    HBV-IN-30
  • HY-148780

    HBV Infection
    HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .
    HBV-IN-29
  • HY-N0677A

    Potassium dehydroandrographolide succinate

    Antibiotic Infection Inflammation/Immunology Cancer
    Kalii Dehydrographolidi Succinas (Potassium dehydroandrographolide succinate), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect .
    Kalii Dehydrographolidi Succinas
  • HY-N0158
    Oxymatrine
    10+ Cited Publications

    TGF-beta/Smad Apoptosis Infection Inflammation/Immunology Cancer
    Oxymatrine, an alkaloid from Sophora flavescens Alt. with anti-inflammatory, antifibrosis, and antitumor effects, inhibits the iNOS expression and TGF-β/Smad pathway. Oxymatrine inhibits bocavirus minute virus of canines (MVC) replication, reduces viral gene expression and decreases apoptosis induced by viral infection.
    Oxymatrine
  • HY-B0307A

    5-Iodo-2′-deoxyuridine hydrate; 5-IUdR hydrate; IdUrd hydrate

    Phosphatase Infection
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) hydrate is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM .
    Idoxuridine hydrate
  • HY-N2840

    Allodulcitol

    Others Metabolic Disease Cancer
    Allitol is a rare natural polyol that can be used as a sweetener. Allitol is an important intermediate for the preparation of the agents which against diabetes, cancer, and viral infections, including AIDS .
    Allitol
  • HY-P5363

    Prostatic Acid Phosphatase(248-286)

    HIV Others
    PAP 248–286 is a biological active peptide. (Prostatic Acid Phosphatase (248-286), PAP (248-286) peptide is a semen-derived enhancer of viral infection (SEVI) factor found in semen. This peptide greatly increases HIV infection through enhanced virion attachment to target cells.)
    PAP 248–286
  • HY-B0307
    Idoxuridine
    3 Publications Verification

    5-Iodo-2′-deoxyuridine; 5-IUdR; IdUrd

    Phosphatase Orthopoxvirus Infection Cancer
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM . Idoxuridine shows anti-orthopoxvirus activity.
    Idoxuridine
  • HY-14231

    CCR Infection Inflammation/Immunology
    CCR5 antagonist 5 (compound example 11) is a CCR5 antagonist. CCR5 antagonist 5 has the potential to study inflammation and immunity and viral (such as HIV) infection .
    CCR5 antagonist 5
  • HY-147321

    Tau Protein HBV Infection Neurological Disease
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .
    3'-DMTr-dG(iBu)
  • HY-144047

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .
    HBV-IN-16
  • HY-144045

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .
    HBV-IN-14
  • HY-144046

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .
    HBV-IN-15
  • HY-156578

    DGK HIV Infection Cancer
    DGKα-IN-8 (Example 51) is a DGKα inhibitor (IC50=22.491 nM; EC50=0.256 nM). DGKα-IN-8 can be used to study cancer, including solid tumors, and viral infections, such as HIV or hepatitis B virus infection .
    DGKα-IN-8
  • HY-138061

    Flavivirus Dengue virus DNA/RNA Synthesis Infection
    DENV-IN-2 is a potent dengue viral replication inhibitor extracted from patent WO2018215315A1, compound 6AB, has an EC50 of 0.016 nM. DENV-IN-2 shows high potent activity against all four serotypes of the Dengue virus with EC50s ranging from 0.013 to 0.029 nM .
    DENV-IN-2
  • HY-12725
    ML324
    5+ Cited Publications

    Histone Demethylase HSV CMV Cancer
    ML324 is a potent JMJD2 demethylase inhibitor with antiviral activity. ML324 also exhibits inhibition for the histone demethylase KDM4B, with an IC50 of 4.9 μM. ML324 has potent anti-viral activity against both herpes simplex virus (HSV) and human cytomegalovirus (hCMV) infection via inhibition viral IE gene expression .
    ML324
  • HY-143750

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-7 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-7 Inhibits the synthesis of viral mRNA and eventually inhibits virus proliferation. Cap-dependent endonuclease-IN-7 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2020177715A1, compound 5)
    Cap-dependent endonuclease-IN-7
  • HY-163546

    HSV Infection
    HSV-1-IN-1 (compound 1b) is a drug candidate for herpes simplex virus HSV-1(IC50=0.5 nM) and HSV-2(IC50=16 nM) infection. HSV-1-IN-1 inhibits the helicase-primase complex to prevent viral replication, thereby inhibiting HSV infection .
    HSV-1-IN-1
  • HY-N2840S

    Allodulcitol-13C

    Isotope-Labeled Compounds Metabolic Disease Cancer
    Allitol- 13C is the 13C labeled Allitol. Allitol is a rare natural polyol that can be used as a sweetener. Allitol is an important intermediate for the preparation of the agents which against diabetes, cancer, and viral infections, including AIDS[1]
    Allitol-13C
  • HY-B0751

    Amebacilin; NSC9168

    Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
    Fumagillin
  • HY-157405

    Dengue virus Infection
    DENV-IN-11 (SC27), a sulfonamide chalcone, is a potent DENV inhibitor that targeted viral methyltransferase. DENV-IN-11 reduced DENV2 replicon replication. DENV-IN-11 can be used for dengue infection research .
    DENV-IN-11
  • HY-158046

    PROTACs STING Infection
    UNC8899 is a VHL-recruiting STING PROTAC degrader (DC50: 0.0.924 μM). UNC8899 can be used for viral or bacterial infection research (Blue: VHL ligand, Black: linker; Pink: STING inhibitor) .
    UNC8899
  • HY-158047

    PROTACs STING Infection
    UNC8900 is a VHL recruiting STING PROTAC degrader (DC50: 0.0.924 μM). UNC8900 can be used for research of viral or bacterial infection. (Blue: VHL ligand, black: linker; Pink: STING inhibitor) .
    UNC8900
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: